Nome do Projeto
VIGILÂNCIA EPIDEMIOLÓGICA E MAPEAMENTO DE ÁREAS DE RISCO ATRAVÉS DA DETECÇÃO MOLECULAR DE Leishmania spp. POR MEIO DE PCR EM FAUNA SILVESTRE NA MICRORREGIÃO DE PELOTAS, RS, BRASIL
Ênfase
Pesquisa
Data inicial - Data final
01/06/2022 - 31/05/2026
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Agrárias
Resumo
A leishmaniose é um complexo de doenças causadas por protozoários tripanossomatídeos de diferentes espécies do gênero Leishmania transmitida pela picada de flebotomíneos. São doenças infecciosas, não contagiosas com manifestações clínicas variadas em humanos e animais. É uma zoonose grave, dada a sua incidência e alta letalidade, e que consiste em um problema de saúde pública preocupante. Antigamente a leishmaniose estava restrita às zonas rurais, e a transmissão ocorria entre vetores e animais silvestres. No entanto, desde a década de 90, tem apresentado mudanças importantes no padrão de transmissão e iniciou um nítido processo de urbanização da enfermidade, além da sua expansão geográfica para os estados mais ao sul do país. A fauna silvestre, portanto, pode representar uma grande fonte de informações em locais que ainda não foram estudados. A identificação de Leishmania spp. nesses animais tem grande relevância no monitoramento da ocorrência da doença e ajuda a estabelecer indicadores ambientais, permitindo a identificação das áreas de risco à infecção para humanos e animais. O objetivo do projeto é caracterizar epidemiologicamente a ocorrência de Leishmania spp. em animais silvestres na microrregião de Pelotas, RS, através da detecção por meio de Reação em Cadeia da Polimerase (PCR), a fim de mapear e identificar possíveis áreas de risco para a infecção humana e animal. Serão coletados animais silvestres mortos por atropelamento, nas rodovias da microrregião de Pelotas, as quais incluem cidades como Pelotas, Capão do Leão, Pedro Osório, Cerrito, Canguçu, Morro Redondo, Turuçu, São Lourenço do Sul, Cristal e Arroio do Padre, no sul do Rio Grande do Sul. Também serão utilizadas carcaças de animais silvestres que venham a óbito durante o período do experimento, provenientes do Núcleo de Reabilitação da Fauna Silvestre (NURFS) e Centro de Triagem de Animais Silvestres (CETAS) da Universidade Federal de Pelotas (UFPel). Os animais serão necropsiados e fragmentos de tecidos serão coletados e congelados a –20 ºC até a realização da Reação em Cadeia da Polimerase (PCR). Os produtos amplificados serão purificados e enviados para sequenciamento genético, submetidos ao Basic Local Alignment Search Tool (BLAST) e comparados às sequências depositadas no GenBank. Todos os pontos de atropelamento do estudo serão mapeados por meio do sistema de posicionamento global (GPS). Com a técnica de PCR, espera-se encontrar a presença de DNA de Leishmania spp. nos animais capturados e através do sequenciamento genético, estima-se identificar e distinguir espécies e cepas do parasito. E a partir disso, mapear e identificar locais de possível infecção, bem como, determinar metodologias de controle e prevenção para impedir a proliferação tanto para outros animais e como humanos.

Objetivo Geral

Caracterizar epidemiologicamente a ocorrência de Leishmania spp. em animais silvestres na microrregião de Pelotas, RS, através da detecção por meio de PCR, a fim de mapear e identificar possíveis áreas de risco para a infecção humana e animal.

Justificativa

A leishmaniose é um complexo de doenças causadas por protozoários tripanossomatídeos de diferentes espécies do gênero Leishmania transmitida pela picada de flebotomíneos. São doenças infecciosas, não contagiosas que possuem sintomatologia variada, e as manifestações clínicas em humanos e animais são subdivididas em leishmaniose cutânea, muco-cutânea e visceral. A enfermidade é uma zoonose grave, dada a sua incidência e alta letalidade, e que consiste em um problema de saúde pública preocupante, tendo os canídeos como principais reservatórios e que acomete principalmente populações de países em desenvolvimento (ALVAR et al., 2012).
No Brasil, até o fim da década de 80, a leishmaniose estava restrita às zonas rurais, e a transmissão ocorria entre vetores e animais silvestres (BRASIL, 2014). No entanto, tem apresentado mudanças importantes no padrão de transmissão e na década de 90 iniciou um nítido processo de urbanização da enfermidade, além da sua expansão geográfica para os estados mais ao sul do país (ALVES e BEVILACQUA, 2004).
Além disso, a expansão urbana humana acarretou não só à perda de habitat para as espécies de animais selvagens, mas também, obrigou-as a ocuparem áreas modificadas e a adaptarem-se à presença de espécies domésticas e ao homem (ACOSTA et al., 2014). Como decorrência dessas interações, podem surgir zoonoses com expansão epidêmica em animais vulneráveis e o aumento da sua disseminação geográfica.
A fauna silvestre, portanto, pode representar uma grande fonte de informações em locais que ainda não foram estudados (THOMPSON, KUTZ e SMITH, 2009). A identificação de Leishmania spp. nesses animais tem grande relevância no monitoramento da ocorrência em uma determinada região e ajuda a estabelecer indicadores ambientais, permitindo a identificação das áreas de risco à infecção, pois estes atuam como marcadores epidemiológicos para a presença do microrganismo, indicando a existência de fontes de infecção para humanos e animais (CANTEROS et al., 2004).
Caldart et al. (2021) avaliaram uma metodologia de detecção molecular de DNA para Leishmania spp., através da Reação em Cadeia da Polimerase (PCR), em órgãos de diferentes espécies de animais atropelados no estado do Paraná, o qual fica próximo a municípios endêmicos no estado paulista, e sugerem o seu uso na vigilância ativa e precoce da leishmaniose em áreas não endêmicas.
Segundo Palmeira (2018), a utilização de ferramentas moleculares sensíveis e específicas, como a PCR, são úteis para estudos epidemiológicos de detecção de protozoários em animais silvestres e que esses são sinalizadores da presença de parasitos no ambiente, além de representar uma alternativa viável para o uso de animais em pesquisas (MARSON, 2016).

Metodologia

O experimento será realizado na Faculdade de Veterinária da Universidade Federal de Pelotas (UFPel), durante o período de março de 2022 a março de 2025.
Serão coletadas carcaças de animais silvestres mortos por atropelamento, preferencialmente preservadas e que não foram completamente desfiguradas, com tempo estimado entre uma e sete horas, nas rodovias da microrregião de Pelotas, as quais incluem cidades como Pelotas, Capão do Leão, Pedro Osório, Cerrito, Canguçu, Morro Redondo, Turuçu, São Lourenço do Sul, Cristal e Arroio do Padre, no sul do Rio Grande do Sul. A equipe do projeto viajará para três rotas pré-estabelecidas: Rota 1 - Pelotas, Turuçu, São Lourenço do Sul e Cristal; Rota 2 – Pelotas, Morro Redondo, Canguçu e Arroio do Padre; Rota 3 - Pelotas, Capão do Leão, Pedro Osório e Cerrito. Cada rota será realizada uma vez ao mês durante um ano com o ponto de partida e chegada sendo a cidade de Pelotas (31° 46' 34'' S; 52° 21' 34'' O). Além do motorista, dois pesquisadores devem acompanhar as rotas, um vigiando o lado direito e outro o lado esquerdo da rodovia. Os animais coletados serão embalados em sacos plásticos, etiquetados com espécie, sexo, data, cidade e local onde foram encontrados e transportados para o Laboratório do Grupo de Estudos em Enfermidades Parasitárias (GEEP) da Universidade Federal de Pelotas (UFPel).
Também serão utilizadas carcaças de animais silvestres que venham a óbito durante o período do experimento, provenientes do Núcleo de Reabilitação da Fauna Silvestre (NURFS) e Centro de Triagem de Animais Silvestres (CETAS) da UFPel.
Os animais serão necropsiados e fragmentos dos tecidos como baço, fígado, rim, coração, pulmão, linfonodos e medula óssea, conforme descrito por Caldart et al. (2021), serão congelados a –20ºC até a realização das análises moleculares.
Para a técnica de Reação em Cadeia da Polimerase (PCR), a extração do DNA será realizada com kit de extração de DNA Kasvi® Mini Spin, segundo instruções do fabricante. O DNA será quantificado em espectrofotômetro (NanoVue-GE Healthcare) obtendo-se valores em nanogramas por microlitros (ng/uL) e estocado a -20 oC até a realização do experimento. A amplificação dos fragmentos de DNA será realizada empregando um par de iniciadores: LITSR (5’ CTGGATCATTTTCCGATG 3’) e L5.8S (5’ TGATACCACTTATCGCACTT 3’) de 453pb, conferido no BLAST. Nas reações, serão utilizados 1,0 μL de DNA e o mix contendo 1,0 μL de dNTP, 1,0 μL cada iniciador, 2,5μL solução tampão, 1,25 μL MgCl2, 0,25 μL de Taq DNA polimerase, e 16 μL de água ultrapura, totalizando 25 μL. As amplificações, em termociclador convencional Bio-Rad® T100, serão: desnaturação inicial a 95oC por 5 minutos, seguidos de 30 ciclos a 95oC por 30 segundos, 50oC por 30 segundos, 72oC por 30 segundos e extensão final de 72oC durante 7 minutos. O controle positivo será o DNA da cepa de Leishmania spp. cedida pelo Laboratório de Parasitologia Veterinária da Universidade Federal de Santa Maria (UFSM). Como controle negativo será utilizada água ultrapura. Os produtos amplificados serão analisados por eletroforese em gel de agarose a 1,5% corados com brometo de etídeo (0,5μg/mL), visualizados em luz ultravioleta e fotografados em aparelho transiluminador. Serão utilizados padrões de peso molecular de 100pb e 50pb. As amostras serão consideradas positivas a partir da visualização de fragmentos com bandas específicas referentes ao par de iniciador. Os produtos amplificados serão purificados e enviados para sequenciamento genético, submetidos ao Basic Local Alignment Search Tool (BLAST) e comparados às sequências depositadas no GenBank.
Todos os pontos de atropelamento do estudo serão mapeados de acordo com o descrito por Caldart et al. (2021), bem como os locais de origem dos animais recebidos pelo NURFS/CETAS, por meio do sistema de posicionamento global (GPS) com o aplicativo móvel My GPS Coordinates.
O método estatístico Qui-quadrado (p < 0,05) será usado para analisar a frequência das amostras positivas para Leishmania spp. dos animais silvestres utilizados neste estudo. Essas análises serão realizadas no programa estatístico SAS, versão 9.2 (SAS, 2009).

Indicadores, Metas e Resultados

Com a técnica de PCR, espera-se encontrar a presença de DNA de Leishmania spp. nos animais capturados e através do sequenciamento genético, estima-se identificar e distinguir espécies e cepas do parasito. E a partir disso, mapear e identificar locais de possível infecção, bem como, determinar metodologias de controle e prevenção para impedir a proliferação tanto para outros animais e como humanos.

Equipe do Projeto

NomeCH SemanalData inicialData final
BIANCA CONRAD BÖHM
DIEGO MOSCARELLI PINTO1
FABIO RAPHAEL PASCOTI BRUHN1
FELIPE GERALDO PAPPEN1
FERNANDA DE REZENDE PINTO1
FERNANDO DA SILVA BANDEIRA1
JULIA SOMAVILLA LIGNON
MARIANA ACCORSI TELES
NATÁLIA SOARES MARTINS
RAQUELI TERESINHA FRANCA1
RODRIGO CASQUERO CUNHA1
SUÉLLEN CAROLINE MATOS SILVA
Sílvia Gonzales Monteiro

Fontes Financiadoras

Sigla / NomeValorAdministrador
CAPES / Coordenação de Aperfeiçoamento de Nível SuperiorR$ 79.200,00Coordenador

Plano de Aplicação de Despesas

DescriçãoValor
339018 - Auxílio Financeiro a EstudantesR$ 79.200,00

Página gerada em 08/02/2023 01:36:32 (consulta levou 0.332974s)