Nome do Projeto
IDENTIFICAÇÃO MOLECULAR DE OVOS DE NEMATÓDEOS DO GÊNERO Toxocara spp. E Lagochilascaris spp., PARASITOS ZOONÓTICOS DE PEQUENOS ANIMAIS, EM PELOTAS, RIO GRANDE DO SUL, BRASIL
Ênfase
Pesquisa
Data inicial - Data final
01/06/2022 - 31/12/2024
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Agrárias
Resumo
O número de animais de estimação vem aumentando nos últimos anos, principalmente nas áreas urbanas. Tal crescimento resulta na aproximação entre humanos e animais de estimação (cães e gatos), o que traz diversos benefícios. No entanto, sabe-se que estes animais estão envolvidos na transmissão de diversas zoonoses parasitárias, dentre estas parasitos do gênero Toxocara spp. e o Lagochilascaris spp. A identificação e diferenciação dos parasitos adultos de Toxocara spp. e Lagochilascaris spp. são relativamente fáceis, porém, os ovos apresentam grande semelhança. Através deste projeto, objetiva-se identificar, por meio de PCR, os ovos de nematódeos dos gêneros Toxocara spp. e Lagochilascaris spp. que acometem cães e gatos na cidade de Pelotas, Rio Grande do Sul, Brasil. Serão utilizadas amostras de fezes de cães e gatos, naturalmente infectados, coletadas em praças públicas, processadas através da técnica de Willis-Mollay (1921). Amostras positivas para ascarídeos serão avaliadas através do método molecular da Reação em Cadeia da Polimerase (PCR) e sequenciamento genético para identificação das espécies. Espera-se, através da PCR, identificar quais ascarídeos que acometem os cães e gatos na cidade de Pelotas, Rio Grande do Sul, Brasil.

Objetivo Geral

Identificar, por meio de PCR, os ovos de nematódeos dos gêneros Toxocara spp. e Lagochilascaris spp. que acometem cães e gatos na cidade de Pelotas, Rio Grande do Sul, Brasil.

Justificativa

O número de animais de estimação vem aumentando nos últimos anos, principalmente nas áreas urbanas. Tal crescimento resulta na aproximação entre humanos e animais de estimação, o que traz diversos benefícios. Esse íntimo contato possibilita um grande ganho em termos de bem-estar físico e mental do tutor e, atua favorecendo ainda mais o desenvolvimento mental e cognitivo de crianças, portadores de doenças psicossomáticas e deficientes físicos, bem como idosos (MACHPERSON, 2005). No entanto, quando a saúde é negligenciada, os animais podem se tornar potenciais transmissores de zoonoses, tornando os humanos suscetíveis a doenças (OLIVEIRA, 2018).
Sabe-se que estes animais estão envolvidos na transmissão de diversas zoonoses parasitárias, dentre estas o gênero Toxocara spp. é frequentemente diagnosticado e duas espécies destacam-se conforme sua importância em saúde pública: Toxocara canis e Toxocara cati (MONTEIRO, 2017). Estes ascarídeos constituem um grupo de agentes etiológicos transmissores da Larva Migrans Visceral (LMV), enfermidade adquirida por ingestão de ovos provenientes destes parasitos que infectam cães e gatos. Nos humanos, as larvas penetram a parede intestinal e migram através dos tecidos levando a alterações diversas, e consequentemente uma resposta inflamatória. As infecções humanas são esporádicas e ocorrem em todo o mundo, atingindo principalmente crianças abaixo de 10 anos de idade, com pico entre um e quatro anos, que, em contato com a sujeira do solo ou areia contaminada por fezes de animais, ingerem acidentalmente os ovos desses parasitos (TIERNEY et al. 2001). Os sinais clínicos variam de casos assintomáticos a graves, dependendo da carga parasitária, órgãos afetados e a resposta imunológica do hospedeiro (MACPHERSON, 2012).
Outro ascarídeo causador de zoonose, denominado como Lagochilascaris minor Leiper (1909), vem sendo encontrado parasitando o homem e eventualmente, o gato e o cachorro (CAMPOS et al. 1992). O primeiro caso humano brasileiro na década de 1960 (ARTIGAS et al. 1968) em uma mulher do estado de São Paulo que apresentava abscessos fistulados no pescoço. A partir desta data, o Brasil passou a deter cerca de 90% dos registros de lagochilascaríase humana mundial (PAÇÔ et al. 1999). Esta enfermidade é uma parasitose crônica e em alguns casos fatal (AQUINO et al., 2008).
Os hospedeiros definitivos (felinos domésticos e silvestres, o homem e o cão) (BARBOSA et al., 2005) albergam o parasito nas primeiras porções do sistema digestivo ou respiratório, eliminando os ovos para o exterior juntamente com as fezes ou por fístulas cervicais. Os ovos, quando embrionados, são ingeridos pelo hospedeiro intermediário, neste caso um roedor, que alberga as larvas encistadas na musculatura. Quando o roedor infectado for ingerido pelo hospedeiro definitivo ou acidental, as larvas de terceiro estágio eclodem dos cistos no estômago, migram para os tecidos da orofaringe, linfonodos cervicais, tecidos do pescoço, mandíbula, seios paranasais, ouvido, alvéolo dentário, pulmões e cérebro, dando origem aos parasitos adultos (CAMPOS et al., 1992). As lesões se apresentam sob forma de pseudocisto, nódulo ou abscesso e quando fistulada drena material soro-purulento contendo ovos, larvas e helmintos adultos (CHIEFFI et al., 1981). O fato de todos os estágios evolutivos serem encontrados no interior da lesão, também é indicativo de autoinfecção (MORAES et al., 1983).
A identificação e diferenciação dos parasitos adultos de Toxocara spp. e Lagochilascaris spp. são relativamente fáceis. No entanto, os ovos são de contorno arredondado ou ovalado, de casca espessa e irregular. Lagochilascaris spp. apresentam de 15 a 26 escavações em torno da linha equatorial, nem sempre contado facilmente, e seu tamanho pode variar de 40-83 x 58-98 µm, evidenciando grande semelhança com os ovos dos demais ascarídeos, como os de Toxocara spp., os quais medem 65-90 x 75 μm (MONTEIRO, 2017).

Metodologia

Local e Período do experimento
O experimento será realizado na Faculdade de Veterinária da Universidade Federal de Pelotas (UFPel), durante o período de maio de 2022 a maio de 2024.

Amostras de fezes
Serão utilizadas amostras de fezes de cães e gatos, naturalmente infectados, coletadas em praças públicas na cidade de Pelotas, Rio Grande do Sul. As amostras serão coletadas em sacos plásticos, identificadas individualmente e armazenadas em recipiente isotérmico com gelo e encaminhadas ao Laboratório do Grupo de Estudos em Enfermidades Parasitárias (GEEP), da Faculdade de Veterinária na Universidade Federal de Pelotas (UFPel) para diagnóstico coproparasitológico. As fezes serão conservadas em geladeira até o processamento, para o qual, será utilizada a técnica de Willis-Mollay (1921). Amostras positivas para ascarídeos serão avaliadas através do método molecular da Reação em Cadeia da Polimerase (PCR) e sequenciamento genético para identificação das espécies.

Avaliação Molecular
Para a técnica de PCR, a extração do DNA será realizada com kit de extração de DNA Kasvi® Mini Spin, segundo instruções do fabricante. O DNA será quantificado em espectrofotômetro (NanoVue-GE Healthcare) obtendo-se valores em nanogramas por microlitros (ng/uL) e estocado a -20 oC até a realização do experimento. A amplificação dos fragmentos de DNA será realizada empregando pares de iniciadores específicos para Toxocara spp. (5’ GGAGTTGTTTAAGTTGGATGG 3’ e 5’ AGAACTCCGCCTTATCAAGACGAC 3’) e Lagochilascaris spp. (5’ ATTGACGGATGRTTTGTACC 3’ e 5’ GTTCCAGAATAATCGGCTA 3’), submetidos ao Basic Local Alignment Search Tool (BLAST) e comparados às sequências depositadas no GenBank. Nas reações, serão utilizados 1,0 μL de DNA e o mix contendo 1,0 μL de dNTP, 1,0 μL cada iniciador, 2,5μL solução tampão, 1,25 μL MgCl2, 0,25 μL de Taq DNA polimerase, e 16 μL de água ultrapura, totalizando 25 μL. As amplificações, em termociclador convencional Bio-Rad® T100, serão: desnaturação inicial a 95oC por 5 minutos, seguidos de 30 ciclos a 95oC por 30 segundos, 50oC por 30 segundos, 72oC por 30 segundos e extensão final de 72oC durante 7 minutos. Os controles positivos serão o DNA de espécimes de Toxocara canis e Lagochilascaris spp. cedidos pelo Laboratório do Grupo de Estudos em Enfermidades Parasitárias (GEEP) da UFPel. Como controle negativo será utilizada água ultrapura. Os produtos amplificados serão analisados por eletroforese em gel de agarose a 1,5% corados com brometo de etídeo (0,5μg/mL), visualizados em luz ultravioleta e fotografados em aparelho transiluminador. Serão utilizados padrões de peso molecular de 100pb e 50pb. As amostras serão consideradas positivas a partir da visualização de fragmentos com bandas específicas referentes ao par de iniciador. Os produtos amplificados serão purificados e enviados para sequenciamento genético, submetidos ao Basic Local Alignment Search Tool (BLAST) e comparados às sequências depositadas no GenBank.

Análises estatísticas
O método estatístico Qui-quadrado (p < 0,05) será usado para analisar a frequência das amostras positivas para cada espécie de ascarídeo encontrada neste estudo. Essas análises serão realizadas no programa estatístico SAS, versão 9.2 (SAS, 2009).

Indicadores, Metas e Resultados

- Através da técnica de PCR, identificar quais as espécies de ascarídeos que acometem os cães e gatos na cidade de Pelotas, Rio Grande do Sul, Brasil.
- A partir dos resultados, indicar algumas condutas visando o controle e prevenção destes parasitos.

Equipe do Projeto

NomeCH SemanalData inicialData final
DIEGO MOSCARELLI PINTO1
FELIPE GERALDO PAPPEN1
JERONIMO LOPES RUAS2
JULIA SOMAVILLA LIGNON
JULIA VICTORIA SANTOS DE SOUZA
LAURA RAFAELA BAUMGARTEN
MARIA GABRIELA CUSTODIO KOBAYASHI
NATÁLIA SOARES MARTINS
VITORIA DE CARVALHO OSCAR

Página gerada em 30/01/2023 02:05:47 (consulta levou 0.128721s)