Nome do Projeto
IDENTIFICAÇÃO MOLECULAR DE HELMINTOS DO GÊNERO Parascaris spp. DE EQUINOS CRIADOS EM PROPRIEDADES LOCALIZADAS NO SUL DO RIO GRANDE DO SUL, BRASIL
Ênfase
Pesquisa
Data inicial - Data final
01/08/2022 - 31/12/2024
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Agrárias
Resumo
As infecções parasitárias são importantes causas de morbidade e mortalidade. Os endoparasitos são uma ameaça frequente para a saúde e bem-estar dos equinos, em particular dos animais jovens, visto que podem ocasionar síndrome cólica, importante causa de mortalidade em cavalos. A criação extensiva favorece as constantes infecções por parasitos presentes nas pastagens. A ascaridiose tem grande importância econômica, pois os animais parasitados apresentam crescimento abaixo do normal, e ocasionalmente, podem causar obstrução intestinal, cólica, ruptura do órgão e peritonite com eventual morte do animal. Parascaris equorum é bem conhecido como um parasita onipresente que infecta potros., mas pouca ou praticamente nenhuma atenção foi dada a existência de Parascaris univalens. As duas espécies são consideradas morfologicamente idênticas, porém P. univalens possui apenas um par de cromossomos da linhagem germinativa em oposição a dois para P. equorum. Muito pouco se sabe sobre a prevalência e abundância desses dois parasitos, principalmente no Brasil. Portanto, o objetivo do estudo é identificar, por meio de PCR, as espécies de nematódeos do gênero Parascaris spp. acometem os equinos criados na região Sul do Rio Grande do Sul, Brasil. Serão utilizadas amostras de fezes de equinos, naturalmente infectados, recebidas dos criatórios de equinos localizados na região Sul do Rio Grande do Sul, Brasil, as quais serão processadas através da técnica de Gordon e Whitlock (1939). Amostras positivas para Parascaris spp. serão avaliadas através do método molecular da Reação em Cadeia da Polimerase (PCR) para identificação das espécies. Espera-se, através da técnica de PCR, identificar qual a espécie de Parascaris spp. acomete os equinos criados na região Sul do Rio Grande do Sul, Brasil.

Objetivo Geral

Identificar, por meio de PCR, as espécies de nematódeos do gênero Parascaris spp. acometem os equinos criados na região Sul do Rio Grande do Sul, Brasil.

Justificativa

A equinocultura tem grande importância no setor econômico brasileiro, cujo mercado possui animais com alto valor zootécnico e, consequentemente, agregação de altos valores financeiros (MINOZZO, 2018).
Entre as patologias que afetam a sanidade de cavalos, as infecções parasitárias são relatadas em equinos ao redor do mundo, sendo importante causa de morbidade e mortalidade (SAES, 2017). Os endoparasitos são uma ameaça frequente para a saúde e bem-estar dos equinos, em particular dos animais jovens, visto que podem ocasionar síndrome cólica, importante causa de mortalidade em cavalos (MADEIRA DE CARVALHO, 2006). Os equinos são hospedeiros de uma grande variedade de helmintos gastrintestinais e podem abrigar várias espécies em um mesmo momento (SAES, 2017).
O fato de grande parte da criação equina brasileira ser realizada de maneira extensiva, onde os animais permanecem a pasto durante todo o ano, favorece as constantes infecções por parasitos presentes nas pastagens (MOLENTO, 2005). A presença de Parascaris spp., causador de ascaridiose em equinos, é mais comumente descrita em animais de até aproximadamente 12 meses de idade, sendo os lactentes e desmamados os mais sensíveis (LYONS et al., 2011). Segundo Laugier et al., (2012), a infecção de cavalos adultos é rara, sendo considerado o parasita mais importante dos animais jovens.
As infecções por Parascaris spp., têm distribuição mundial e possuem grande importância econômica, pois os animais parasitados apresentam crescimento abaixo do normal, devido à interferência na digestão e absorção de alimentos, e ocasionalmente, podem causar obstrução intestinal, cólica, ruptura do órgão e peritonite com eventual morte do animal (RIET-CORREA, 2007; CABAÇO, 2014).
As fêmeas de Parascaris spp. podem eliminar até 200 mil ovos por dia, e estes permanecem viáveis por muito tempo no ambiente (RIET-CORREA et al., 2007), por essa razão, uma das principais fontes de infecção para os potros são as pastagens ou cocheiras utilizadas anteriormente por outros potros ou até mesmo pelas éguas, uma vez que animais adultos podem ter o papel de reservatórios assintomáticos dos parasitos (FRASER, 1996).
O parasito Parascaris equorum é bem conhecido como um parasita onipresente que infecta potros. Uma espécie semelhante, Parascaris univalens, foi descrita pela primeira vez há mais de 130 anos, mas pouca ou praticamente nenhuma atenção foi dada à sua existência e possíveis implicações para a resistência anti-helmíntica, doença clínica ou espectro de idade do hospedeiro. P. univalens possui apenas um par de cromossomos da linhagem germinativa em oposição a dois para P. equorum, mas as duas espécies são consideradas morfologicamente idênticas (NIELSEN et al. 2014). Muito pouco se sabe sobre a prevalência e abundância desses dois parasitos. Um estudo italiano de prevalência foi realizado na década de 1970, e relataram 93% de 2.238 espécimes examinados para serem P. univalens, com o restante sendo P. equorum ou híbridos entre as duas espécies (BULLINI et al. 1978). Análises semelhantes de numerosos espécimes na Espanha só identificaram P. univalens (ESTEBAN et al. 1995). Em conjunto, essas observações sugerem que P. univalens pode ser a espécie de ascarídeos equinos predominantes, enquanto P. equorum pode ser bastante raro em comparação.

Metodologia

Local e Período do experimento
O experimento será realizado na Faculdade de Veterinária da Universidade Federal de Pelotas (UFPel), durante o período de maio de 2022 a maio de 2024.

Amostras de fezes
Serão utilizadas amostras de fezes de equinos, naturalmente infectados, recebidas através de veterinários e/ou proprietários dos criatórios de equinos localizados nas cidades de Arroio Grande (-32.08220, -52.97453), Bagé (-31.34830, -54.10998) e Pelotas (-31.7231, -52.51552), na região Sul do Rio Grande do Sul, Brasil. As amostras deverão ser enviadas em sacos plásticos, identificadas individualmente e armazenadas em recipiente isotérmico com gelo. As fezes serão conservadas em geladeira até o processamento, para o qual, será utilizada a técnica de Gordon e Whitlock (1939) fornecendo o resultado em ovos por grama de fezes (OPG). Amostras positivas para Parascaris spp. serão avaliadas através do método molecular da Reação em Cadeia da Polimerase (PCR) para identificação das espécies.

Avaliação Molecular
Para a técnica de PCR, a extração do DNA será realizada com kit de extração de DNA Kasvi® Mini Spin, segundo instruções do fabricante. O DNA será quantificado em espectrofotômetro (NanoVue-GE Healthcare) obtendo-se valores em nanogramas por microlitros (ng/uL) e estocado a -20 oC até a realização do experimento. A amplificação dos fragmentos de DNA será realizada empregando pares de iniciadores específicos para P. equorum (5’ TGGAGCCTTACAATGCAAC 3’ e 5’ CTGGATTAGACAACTTCAGCG 3’) de 123pb e P. univalens (5’ TGAGTCTTGTTTTCTAGGGTGAA 3’ e 5’ GATGATTTGTACCGCCCCCA 3’) de 433pb, submetidos ao Basic Local Alignment Search Tool (BLAST) e comparados às sequências depositadas no GenBank. Nas reações, serão utilizados 1,0 μL de DNA e o mix contendo 1,0 μL de dNTP, 1,0 μL cada iniciador, 2,5μL solução tampão, 1,25 μL MgCl2, 0,25 μL de Taq DNA polimerase, e 16 μL de água ultrapura, totalizando 25 μL. As amplificações, em termociclador convencional Bio-Rad® T100, serão: desnaturação inicial a 95oC por 5 minutos, seguidos de 30 ciclos a 95oC por 30 segundos, 50oC por 30 segundos, 72oC por 30 segundos e extensão final de 72oC durante 7 minutos. O controle positivo será o DNA de um espécime de Parascaris equorum cedido pelo Laboratório de Parasitologia Veterinária (LAPAVET) da Universidade Federal de Santa Maria (UFSM). Como controle negativo será utilizada água ultrapura. Os produtos amplificados serão analisados por eletroforese em gel de agarose a 1,5% corados com brometo de etídeo (0,5μg/mL), visualizados em luz ultravioleta e fotografados em aparelho transiluminador. Serão utilizados padrões de peso molecular de 100pb e 50pb. As amostras serão consideradas positivas a partir da visualização de fragmentos com bandas específicas referentes ao par de iniciador.

Análises estatísticas
O método estatístico Qui-quadrado (p < 0,05) será usado para analisar a frequência das amostras positivas para cada espécie de Parascaris spp. encontrada neste estudo. Essas análises serão realizadas no programa estatístico SAS, versão 9.2 (SAS, 2009).

Indicadores, Metas e Resultados

- Através da técnica de PCR, identificar qual a espécie de Parascaris spp. que acomete os equinos criados na região Sul do Rio Grande do Sul, Brasil.
- Determinar a melhor metodologia de prevenção e controle, a partir da epidemiologia da espécie identificada.

Equipe do Projeto

NomeCH SemanalData inicialData final
DIEGO MOSCARELLI PINTO1
FELIPE GERALDO PAPPEN1
JERONIMO LOPES RUAS2
JULIA SOMAVILLA LIGNON
JULIA VICTORIA SANTOS DE SOUZA
LAURA RAFAELA BAUMGARTEN
MARIA GABRIELA CUSTODIO KOBAYASHI
NATÁLIA SOARES MARTINS
VITORIA DE CARVALHO OSCAR

Página gerada em 30/01/2023 01:52:44 (consulta levou 0.072981s)