Nome do Projeto
Ocorrência de Cryptococcus spp. em pombos (Columba livia)
Ênfase
Pesquisa
Data inicial - Data final
02/04/2020 - 01/04/2022
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Biológicas
Resumo
A criptococose é uma doença fúngica causada pelos agentes Cryptococcus neoformans e Cryptococcus gattii. É endêmica no Brasil e de grande importância na medicina humana para pacientes imunocomprometidos e na medicina veterinária para as espécies felina e canina. A infecção ocorre principalmente a partir da inalação de conídios das fezes de pombos (Columba livia), que estão presentes em grandes aglomerações nas zonas urbanas. O objetivo do projeto é avaliar a presença de Cryptococcus spp. em órgãos de pombos, levando em consideração os sítios de eleição do agente e posteriormente avaliar se há alterações histopatológicas nos órgãos afetados. Serão capturados exemplares de pombos em praças e prédios públicos e privados da cidade de Pelotas- RS. As aves serão submetidas a eutanásia e posteriormente será realizada necropsia onde serão coletados pulmão, cérebro e intestino. Fragmentos dos órgãos coletados serão processados para isolamento e semeados em placas de ágar niger em duplicata. As placas serão incubadas em estufa bacteriológica a 37°C/10 dias. Colônias suspeitas de Cryptococcus spp. serão avaliadas em exame direto com tinta da China e analisadas por microscopia óptica e caracterizadas em nível de espécie por provas bioquímicas e identificação molecular. Para análise histopatológica parte dos órgãos coletados serão fixados em formalina 10% e submetidos a coloração de hematoxilina e eosina (HE) e Grocott. Com essa proposta espera-se contribuir com atualizações para estudos de fungos e sua atuação no organismo de hospedeiros, divulgando resultados através de artigos em revistas indexadas da área de estudo e congressos

Objetivo Geral

Avaliar a ocorrência de Cryptococcus spp. em órgãos de pombos (Columba livia) na cidade de Pelotas – RS, bem como verificar a presença de lesões histopatológicas ocasionadas pelo fungo

Justificativa

Os pombos (Columba livia) apresentam importância epidemiológica na transmissão da criptococose. Estudos prévios evidenciaram a presença de Cryptococcus neoformans em 10-32% das fezes de pombos analisadas e as aves da família Columbidae são reconhecidas como disseminadoras do fungo pelo enriquecimento do solo com suas fezes, onde estão presentes as leveduras que, quando inaladas, são capazes de causar a doença em humanos e animais (FARIA et al., 2010; SOUZA et al., 2018; LIMA et al., 2015). Apesar de ser um consenso quase que unânime de que o fungo não se multiplica no organismo dessas aves devido a sua temperatura corporal elevada e que passaria diretamente pelo trato digestivo às fezes, não foram encontrados na literatura estudos que comprovem que os Columbidaes não podem ser acometidas pela enfermidade. Contrapondo essa ideia, um relato de caso muito raro de criptococose clínica em aves foi constatado, ocorrido em psitacídeos provenientes de um aviário no Brasil contaminados por C. gattii o qual foi relacionado à inalação do agente nos galhos de eucaliptos utilizados como poleiros, o que sugere que esses animais não eram carreadores do agente (RASO et al., 2004).
Na cidade de Pelotas- RS estas aves incluem-se em grande parte da população de aves encontradas em áreas urbanas e estão dentre as quatro espécies de maior abundância relativa e com maior frequência de ocorrência, com variação sazonal insignificante (SACCO et al., 2013).
Levando em consideração o risco de infecções em indivíduos imunocomprometidos e em animais, estudar aspectos do ciclo do Cryptococcus spp. nessa espécie torna-se importante para que se possa buscar medidas de prevenção, principalmente ao levar em consideração a superpopulação de pombos em grandes prédios e centros das cidades onde os grupos de risco circulam e entram em contato com o agente presente nas fezes dessas aves.

Metodologia

Serão capturados exemplares de pombo (n=100, dos quais 50 jovens e 50 adultos) por meio da utilização de rede de neblina e captura manual em ninhos nas praças e prédios públicos e privados da cidade de Pelotas- RS onde são observadas aglomerações desses animais e acúmulos de suas fezes. Estes animais serão submetidos a eutanásia induzida por isoflurano embebido em algodão via inalatória e posteriormente será realizada necropsia, onde serão coletados os órgãos de eleição do fungo: pulmão, cérebro e intestino. Estes procedimentos fazem parte de uma parceria com o projeto “Fauna parasitária de Columba livia (GMELIN, 1789) (Aves: Columbidae) capturados no município de Pelotas, Rio Grande do Sul, Brasil” registrada com o n° 23110.012860/2018-81, que foram submetidos e aprovados pelo Comitê de Ética em Experimentação Animal (CEEA) com código de cadastro nº CEEA 12860-2018 e autorização de SISBIO número 61235-2.
A amostragem foi estimada por proporção simples, conforme descrito por THRUSFIELD (2005) com nível de confiança de 90%, precisão de 5% e prevalência aparente de 10%.

Isolamento fúngico:
Fragmentos dos órgãos coletados serão macerados, transferidos para tubos tipo falcon contendo 9mL de solução salina a 0,9% em uma proporção aproximada de 1:9, agitados em vórtex e incubados a 37°C em estufa em agitação constante (150 rpm) durante 60 minutos. Após um descanso de 15 minutos, um volume de 100 μL do sobrenadante será semeado em placas de ágar Niger, em duplicata, e homogeneizados com auxílio de uma alça de Drigalski. As placas serão incubadas em estufa bacteriológica a 25°C com acompanhamento diário durante 10 dias.
As colônias com características similares às de Cryptococcus spp. serão submetidas ao exame direto com tinta da China e analisadas por microscopia óptica. Quando confirmada a presença de células leveduriformes envolvidas por ampla cápsula, as colônias serão repicadas para obtenção de culturas puras.

Cultivo em ágar CGB (canavanina- glicina- azul de bromotimol)
As culturas puras isoladas serão submetidas à identificação preliminar em nível de espécie sendo repicadas em tubos com meio CGB e incubadas por até 5 dias a 25°C com acompanhamento diário da coloração do meio. As colônias capazes de utilizar a glicina e alterar a coloração para azul-cobalto indicam C. gattii e, mantendo a coloração inicial, indica C. neoformans.

Análise molecular:
As amostras isoladas serão encaminhadas para tipificação dentre os oito tipos moleculares conhecidos. Para tal, as amostras serão enviadas em estoques de glicerol a -70°C para processamento na Universidade Federal de Santa Maria (UFSM) sendo empregada a metodologia previamente descrita por MEYER et al. (2003). Seguindo este método, um conjunto de cepas padrã-referência de C. neoformans, representantes de cada tipo molecular, serão utilizadas nas reações de PCR fingerprint e URA5 RFLP, incluindo as cepas: WM 148 (sorotipo A, VNI), WM 626 (sorotipo A, VNII), WM 628 (sorotipo AD, VNIII), WM 629 (sorotipo D, VNIV), WM 179 (sorotipo B, VGI), WM 178 (sorotipo B, VGII), WM 161 (sorotipo B, VGIII) e WM 779 (sorotipo C, VGIV). Para a extração do DNA total uma amostragem de cada colônia isolada será retirada com auxílio de uma alça bacteriológica, suspendida em água deionizada estéril e centrifugado. O sobrenadante será descartado e o tubo tipo eppendorf contendo o sedimento de células da levedura será congelado em nitrogênio líquido. O precipitado será triturado com um pilão em miniatura e a a solução de lise celular (100 mg de ácido triisopropilnaftaleno sulfônico, 600 mg ácido para-aminosalicílico, 10 mL de água deionizada estéril, 2,5 mL de tampão de extração composto por Tris-HCl 1 M, NaCl 1,25 M, 0,25 M EDTA, pH 8,0) e 7,5 mL de fenol saturado com Tris-EDTA será pré-aquecido a 55 ° C, e posteriormente adicionados 700 µL desta mistura para as células trituradas e congeladas. Os tubos ficarão incubados por 2 min a 55 ° C, agitados ocasionalmente e adicionado 500 µL de clorofórmio, e a mistura novamente incubada por 2 minutos a 55 ° C e agitada. Os tubos sofrerão incubação por 10 min a 14.000 rpm, e a fase aquosa restante transferida para um novo tubo. Após, 500 µL de álcool fenol-clorofórmio-isoamílico será adicionado, agitado por 2 min em temperatura ambiente, e centrifugado como citado acima.
Para precipitação do DNA genômico, a fase aquosa será novamente transferida para outro tubo com 0,03 volumes de acetato de sódio 3M (pH 5,2) e 2,5 volumes de etanol a 96%, agitando a mistura e incubando a -20 ° C por pelo menos 1h ou overnight. A solução deverá ser centrifugada por 30 min a 14.000 rpm e o sedimento de DNA lavado com etanol a 70%, centrifugado por 10 min a 14.000 rpm e seco ao ar. O DNA passará por ressuspensão em 200 µL de água desionizada estéril a 4 ° C durante a noite e armazenado a –20 ° C.
Para a realização do PCR fingerprinting, a sequência 5’GAGGGTGGCGGTTCT3′ será usada como primer na PCR. As reações de amplificação serão realizadas em um volume de 50 µL contendo 25 ng de DNA genômico de alto peso molecular, Tris-HCl 10 mM, pH 8,3, 50 mM KCl, 1,5 mM MgCl, 0,2 mM em cada um dos dATP, dCTP, dGTP e dTTP, acetato de magnésio 3 mM, 30 ng de primer e 2,5 U Taq DNA polimerase. A PCR será realizada por 35 ciclos em um termociclador com 20 segundos de desnaturação a 94 ° C e extensão de 20 segundos a 72 ° C, seguido por um ciclo de extensão final por 6 minutos a 72 °C. Os produtos da amplificação serão removidos, concentrados a aproximadamente 20 µL e separados por eletroforese em gel de agarose a 1,4% (corados com brometo de etídio, estocados em 10 mg / mL) 1 vez em tampão Tris-borato-EDTA (TBE) a 60 V por 14 cm e visualizado em Luz UV.
A reação de URA5 RFLP será realizada com 50 ng de DNA, 1 tampão de PCR (Tris-HCl 10 mM, pH 8,3, KCl 50 mM, MgCl2 1,5 mM, 0,2 mM cada de dATP, dCTP, dGTP e dTTP, 3 mM acetato de magnésio, DNA Taq polimerase 1,5 U e 50 ng de cada iniciador URA5 (5' ATGTCCTCCCAAGCCCTCGACTCCG 3') e SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3'), com volume final de 50 µL e ocorrendo 35 ciclos em um termociclador a 94 ° C por 2 min de desnaturação inicial, 45 s de desnaturação a 94 ° C e 2 minutos de extensão a 72 ° C, seguidos por um ciclo de extensão final de 10 min a 72 ° C. Os produtos de amplificação posteriormente serão misturados com 20% de tampão de corrida (Ficoll 400 a 15%, 0,25% orange G e água MilliQ), 15 µL de produtos de PCR digeridos duas vezes com as enzimas Sau96I (10 U / µL) e HhaI (20 U / µl) por 3 h ou overnight e separados por eletroforese em gel de agarose a 3% a 100 V por 5 h. As impressões digitais serão visualizadas e comparadas com o padrão obtido com as nas cepas-referência determinando o tipo molecular de cada isolado.

Análise histopatológica:
Fragmentos de cérebro, pulmão e intestino serão fixados em formalina 10%, rotineiramente processados para análise histopatológica e submetidos a coloração de hematoxilina e eosina (HE) (para visualização de possíveis alterações teciduais causadas pela presença do fungo no organismo do hospedeiro), Grocott e Mucicarmim de Mayer (para visualização de estruturas fúngicas e cápsula, respectivamente).

Indicadores, Metas e Resultados

Espera-se contribuir cientificamente em aspectos epidemiológicos e biológicos da criptococose, buscando informações inovadoras sobre a capacidade do Cryptococcus spp. em causar doença em pombos infectados e identificando as amostras quanto suas características morfológicas e moleculares.

Equipe do Projeto

NomeCH SemanalData inicialData final
AUGUSTO DUARTE BROD
CAROLINA DOS SANTOS BERMANN
CAROLINE QUINTANA BRAGA
DANIELA ISABEL BRAYER PEREIRA1
JOSIANE BONEL1
LUÍZE GARCIA DE MELO
RENATA OSORIO DE FARIA1
Sônia de Avila Botton
WALDENIS PEREIRA DA TRINDADE JUNIOR

Página gerada em 24/01/2021 09:32:47 (consulta levou 0.113868s)