Nome do Projeto
Análise de compostos bioativos e expressão gênica de enzimas da rota de biossíntese de glicosídeos de esteviol em S. rebaudiana - ETAPA II - Identificação de possíveis mutações no gene UGT76G1, gene chave na síntese de glicosídeos de esteviol
Ênfase
Pesquisa
Data inicial - Data final
03/08/2020 - 31/07/2022
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Agrárias
Resumo
Stevia rebaudiana Bertoni, popularmente conhecida como estevia merece muita atenção, não só por acumular edulcorantes de baixa caloria, mas também compostos com atividade antioxidante. Esta planta contém, principalmente em suas folhas, um açúcar natural sem calorias, cerca de 200-300 vezes mais doce do que o açúcar da cana (Saccharum officinarum). Os componentes primários responsáveis por estas propriedades doces são os glicosídeos de esteviol (GSs) que são uma mistura de pelo menos oito tipos diferentes, incluindo esteviosídeo (triglicosídico) e o rebaudiosídeo A (tetraglicosídico). A biossíntese dos GSs ocorre principalmente nas folhas e compartilha uma via em comum com as giberelinas. A primeira parte consiste na via 2-C-metil-D-eritritol-4-fosfato (MEP), que produz duas unidades de isopreno, isopentenil difosfato (IPP) e dimetilalil difosfato (DMAPP) a partir de piruvato e gliceraldeído-3-fosfato. Posteriormente, ocorre a síntese do ácido caurenoico através da ação de três enzimas: copalil difosfato sintase (CPPS), caureno sintase (KS), caureno oxidase (KO) e por último, ocorre a hidroxilação do ácido caurenoico e a glicosilação do esteviol. Os dois grupos funcionais oxigenados de esteviol (carboxilato do C-19 e o álcool do C-13) fornecem pontos de fixação para as cadeias laterais de açúcar e determinam a identidade dos diferentes glicosídeos. A adição de uma glicose no C-13 do esteviol é catalisada pela UGT85C2, primeiro produzindo esteviolmonoside e depois esteviolbioside, a adição da glicose no C-19 é catalisada pela UGT74G1 formando o esteviosideo e finalmente a glicosilação no C-3 e 13 é catalisada pelo UGT76G1, ocasionando como produto o rebaudiosídeo A. Estudos prévios em plantas de estevia cultivadas no Brasil mostraram baixos níveis de rebaudiosídeo A, como o gene UGT76G1 é responsável pela conversão do esteviosídeo em rebaudiosídeo A, a descoberta de possíveis mutações neste gene pode ajudar a elucidar o mecanismo por trás do baixo acúmulo de rebaudiosídeo A nas folhas de alguns genótipos de estevia, e também melhorar nossa compreensão sobre a funcionalidade da UGT76G1 e sua relação com a síntese de rebaudiosíodeo A.

Objetivo Geral


Identificar possíveis mutações no gene UGT76G1 em plantas de Stevia rebaudiana cultivadas no Brasil (que produzem níveis muito baixos de rebaudiosídeo A) e nas plantas oriundas da Espanha (que produzem níveis satisfatórios de rebaudiosídeo A), através de análises cromatográficas e de sequenciamento, bem como de ensaios enzimáticos.

Justificativa

As plantas medicinais são de grande importância para a saúde de indivíduos e comunidades. O valor medicinal dessas plantas reside em algumas substâncias químicas que produzem uma ação fisiológica definitiva no corpo humano (LEMUS-MONDACA et al., 2012). Estima-se que entre 60-90% da população de países em desenvolvimento usam remédios tradicionais à base de plantas (ROSA; CÂMARA; BÉRIA, 2011). Esta tendência por cuidados de saúde alternativos e complementares levou os pesquisadores a investigar as várias atividades biológicas das plantas medicinais (WENDAKOON et al., 2011).
Entre estas plantas, Stevia rebaudiana Bertoni, pertencente à família Asteraceae (Compositae), e popularmente conhecida como stevia, estévia ou erva doce, é nativa do Paraguai e do Brasil, merece atenção (LEMUS-MONDACA et al. 2012; YADAV; GULERIA, 2012), não só por acumular edulcorantes de baixa caloria, mas também compostos com atividade antioxidante (MADAN et al., 2010; BENDER et al., 2015). Esta planta contém, principalmente em suas folhas, um açúcar natural sem calorias, cerca de 200-300 vezes mais doce do que o açúcar da cana (Saccharum officinarum) (CEUNEN; GEUNS, 2013). Os componentes primários responsáveis pelas propriedades doces desta planta são os glicosídeos de esteviol (GSs) que, de acordo com Prakash (2011), são uma mistura de pelo menos oito tipos diferentes, incluindo esteviosídeo (ST), rebaudiosídeo A-F (RA-RF), rubusosídeo e dulcosídeo A, um novo diterpeno glicosídico recentemente isolado. O esteviosídeo (triglicosídico) e o rebaudiosídeo A (tetraglicosídico) são compostos únicos no mundo vegetal e representam a maioria dos GSs estando presentes em alta concentração no tecido foliar (GEUNS et al., 2003; RICHMAN et al., 2005)
A biossíntese dos GSs ocorre principalmente nas folhas (BRANDLE; ROSA, 1992; BEHROOZI et al., 2017) e compartilha uma via em comum com as giberelinas. A primeira parte consiste na via 2-C-metil-D-eritritol-4-fosfato (MEP), que produz duas unidades de isopreno, isopentenil difosfato (IPP) e dimetilalil difosfato (DMAPP) a partir de piruvato e gliceraldeído-3-fosfato. Posteriormente, a fase seguinte resulta na biossíntese do ácido caurenoico através da ação de quatro enzimas: copalil difosfato sintase (CPPS), caureno sintase (KS), caureno oxidase (KO) e caureno ácido hidroxilase (KAH) (HUMPHREY et al., 2006; BRANDLE; TELMER, 2007; YADAV; GULERIA, 2012).
Por último, ocorre a hidroxilação do ácido caurenoico e a glicosilação do esteviol, catalisado por UDP-glicosiltransferases produzindo diferentes GSs (RICHMAN et al., 1999, 2005). Dentro das 12 UGTs até agora elucidadas em S. rebaudiana, três (UGT76G1, UGT74G1 e UGT85C2) foram estudados (RICHMAN et al., 2005). Os dois grupos funcionais oxigenados de esteviol, o carboxilato do C-19 e o álcool do C-13, fornecem pontos de fixação para as cadeias laterais de açúcar e determinam a identidade dos diferentes glicosídeos. A adição de uma glicose no C-13 do esteviol é catalisada pela UGT85C2, primeiro produzindo esteviolmonoside e depois esteviolbioside, a glicose no C-19 é catalisada pela UGT74G1 e forma o esteviosideo (SHIBATA et al., 1995, 1991) e finalmente a glicosilação no C-3 e na posição C-13 é catalisada pelo UGT76G1, que forma o rebaudiosídeo A (RICHMAN et al., 1999; BRANDLE e TELMER, 2007).
Estudo prévios com plantas de estevia oriundas do Brasil mostraram baixos níveis de rebaudiosídeo A. Yan et al. (2014) também encontraram níveis muito baixos de rebaudiosídeo A em folhas de estévia oriundas de alguns genótipos, esses autores descobriram uma mutação no gene candidato UGT76G1 causada por uma mutação nonsense, que induz a uma parada prematura do códon, resultando em uma proteína com estrutura espacial alterada. Estudos como o relatado por Yan et al. (2014) pode ajudar a elucidar o mecanismo por trás do baixo acúmulo de rebaudiosídeo A nas folhas de alguns genótipos de stevia, e pode melhorar nossa compreensão sobre a funcionalidade da UGT76G1 e sua relação com a síntese de rebaudiosíodeo A.

Metodologia

Material vegetal e quantificação dos GSs por HPLC
Amostras de folhas de S. rebaudiana cultivadas no Brasil e na Espanha serão coletadas. Para a obtenção dos extratos foliares as amostras serão homogeneizadas em 3 mL de etanol (70%), o restante da extração será realizada de acordo com Lucho et al. (2018) com pequenas modificações. O conteúdo de GSs será determinado usando HPLC-DAD: Jasco LC-NetII/ADC, conforme descrito por JECFA (2010). Uma mistura de acetonitrila:tampão fosfato 10 mM, pH 2,6 (32:68 v/v) será utilizada como fase móvel e aplicada com uma vazão de 1 mL min-1. A identificação dos GSs nos extratos será feita comparando os espectros de UV e os tempos de retenção de rebaudiosídeo A, assim como dados da literatura. O conteúdo de GSs será expresso em mg equivalentes de rebaudiosídeo A por grama.

Preparo das amostras para sequenciamento
A extração do DNA será realizada de acordo com Doyle; Doyle (1987). Serão macerados 100 mg de folhas e adicionado, 900 µL de tampão de CTAB 2% na amostra e após será realizada a incubação em banho-maria a 60°C, por 45-60 minutos. Após esse período, será adicionado 900 µL de clorofórmio:álcool isoamílico (24:1) e centrifugada a 12.000g por 10 min a 4°C. A fase aquosa será transferida para novos tubos e adicionado igual volume de etanol gelado. Após mistura por inversão será deixado em overnight a -20 °C. A seguir as amostras serão centrifugadas a 12.000g por 10 min. O precipitado formado será lavado com 1 mL de etanol 70% e após descarte do sobrenadante nova lavagem com 300 µL de etanol 100 %. O sobrenadante será vertido novamente e deixado secar o pellet a temperatura ambiente e posteriormente adicionou-se 30 µL de TE + RNase. A qualidade e quantidade do DNA extraído das amostras será verificado em gel de agarose 0,8 %, utilizando o marcador de peso molecular Lambda DNA/HindIII.
As reações de PCR serão realizadas em triplicata em cada um dos genótipos. O gene UGT76G1 será amplificado por primers especificos F:CACCATCTTTCACACCAACTTCA e R: ATGCGTTCGTCTTGTGGGT. As condições de ciclagem serão: renaturação das amostras por 2 min a 50 ºC e ativação da enzima Taq Polymerase por 10 min a 95ºC. Posteriormente, serão feitos 40 ciclos contendo três etapas (95 ºC por 30s, 60 ºC por 1 min e 72 ºC por 1 min) e finalmente uma última etapa a 72 ºC por 5 minutos.

Sequenciamento dos produtos de amplificação da PCR
Após execução da PCR, os produtos da amplificação (bandas) serão purificados com o kit Gene JET PCR Purification da Thermo Scientific® e as concentrações padronizadas para 50 ng ul-1, além dos primers padronizados para 10 μM e encaminhados para o sequenciamento. O sequenciamento será realizado pelo método Sanger utilizando o aparelho Genetic Analyzer 3500 (Aplied Biosystems, EUA), do Laboratório de Genômica Estrutural pertencente ao Centro de Desenvolvimento Tecnológico (CDTec) da UFPEL.

Análise in silico dos resultados do sequenciamento
As análises do resultado do sequenciamento serão processadas in silico para investigar e remover os nucleotídeos de baixa qualidade através do software Chromas®. O alinhamento das sequências será executado no software Clustal X2 (THOMPSON et al., 1997) e comparadas com as sequências já depositadas no banco de dados do National Center for Biotechonology Information (NCBI) com o auxílio do Basic Local Alignment Search Tool (BLASTN) localizado no sítio https//:blast.ncbi.nlm.nih.gov/Blast.

RT-qPCR da UGT76G1
O RNA total será extraído a partir de 100 mg de folhas de S. rebaudiana de acordo com o protocolo do fabricante (Plant RNA Reagent Purilink® EUA). A quantidade e a pureza do RNA serão determinadas utilizando um NanoDrop ND-1000 e a qualidade e a integridade de RNA serão verificadas através de electroforese num gel de agarose a 1,0%. Os cDNAs de cadeia simples serão sintetizados utilizando o Kit RT-PCR (Invitrogen®-18080093, EUA).
As reações de RT-qPCR serão realizadas em um Termociclador em Tempo Real Bio-Rad CFX, EUA, utilizando o kit Universal FastStart SYBR Green Master (Rox). Os genes UBQ e ACT serão usados como internos para normalizar os dados individualmente das reações de RT-qPCR (LUCHO et al. 2018b). A quantificação relativa será executada pelos valores comparativos de 2-ΔΔCT, onde ΔΔCT = (CT da amostra tratada - CT da média UBQ e ACT) - (CT da amostra controle - CT da média UBQ e ACT), segundo o método de LIVAK E SCHMITTGEN (2001). Três repetições técnicas serão realizadas para cada repetição biológica.

Extração das GTases
Folhas superiores das plantas de estevia serão pulverizadas em nitrogênio líquido. O homogenato será suspenso em 25 mL de tampão A (tampão Tris e HCl 50 mM (pH 7,0) contendo 2-mercaptoetanol 2 mM e sacarose 0,4 mM). A suspensão será removida por centrifugação (15.000 g durante 30 min a 4°C). O sobrenadante será levado a uma saturação de 30% pela adição de sulfato de amónio sólido, agitando lentamente durante 1h e centrifugado a 8000g durante 10 min. A concentração do sobrenadante será aumentada para 80% de saturação e agitada durante 1h e posteriormente centrifugada a 5000g durante 30 min. O precipitado será dissolvido em 5 mL de tampão A e diluído para 10 mL (SHIBATA et al., 1995).

Ensaio enzimático da UGT76G1
A atividade da UGT76G1 será verificada por ensaio enzimático. O substrato esteviosídeo (0,1 mM) será incubado com 100 mL de GTases extraídas por 1 h a 32° C em mistura de reação contendo 1 mM de UDP Glicose, 100 mM Tris e HCl (pH 7,0) e 5 mM MgCl2 (SHIBATA et al., 1995; LIEBL et al., 1992). Após o período de incubação, a mistura reacional será centrifugada a 10000 g para recolher a fase aquosa. A reação de controle será feita com água. A amostra será injetada numa coluna ligada a sílica e aminopropilo (4,6 250 mm) à temperatura ambiente. A fase móvel será acetonitrila:água 80:20 (v/v) e a taxa de fluxo será ajustada para 1,2 mL min a 210 nm de comprimento de onda. O tempo de retenção de esteviosídeo e rebaudiosídeo A será detectado separadamente, através de HPLC.

Indicadores, Metas e Resultados

0 -12 meses
Análises cromatográficas
Construção dos primers
Extração de DNA e análises de PCR
Sequenciamento dos produtos de amplificação da PCR

13-24 meses
Análise in silico dos resultados do sequenciamento através de softwares específicos
Extração das UDP-glicosiltransferases (UGT76G1)
Ensaios atividade enzimática em HPLC
Análise dos resultados

Coletivamente, os resultados podem ajudar a ter uma visão mais ampla da atividade das UDP-glicosiltransferases em estevia, incluindo a enzima SrUGT76G1. Adicionalmente, permitirá identificar se as diferenças no conteúdo de Rebaudioside A observados em ambos os genótipos é devido a um stop códon prematuro ou por diferenças na sequencia de bases e aminoácidos. Uma vez identificada a mutação (indels), tecnologias avançadas como o sistema CRISPR/Cas que utiliza a engenharia de endonucleases para gerar uma quebra na cadeia dupla do DNA (DSB) na região alvo oferecem novas oportunidades para explorar e manipular estas mutações.

Equipe do Projeto

NomeCH SemanalData inicialData final
EUGENIA JACIRA BOLACEL BRAGA1
JAQUELINE DA SILVA DOS SANTOS
KATHARINA ROJAHN WICKBOLDT
LAURA LUZ NUNES
SIMONE RIBEIRO LUCHO
VALMOR JOAO BIANCHI2

Fontes Financiadoras

Sigla / NomeValorAdministrador
CAPES / Coordenação de Aperfeiçoamento de Nível SuperiorR$ 1.750,00Coordenador

Plano de Aplicação de Despesas

DescriçãoValor
339030 - Material de ConsumoR$ 1.750,00

Página gerada em 10/08/2022 01:13:01 (consulta levou 0.074284s)