Nome do Projeto
História evolutiva do elemento P no complexo Drosophila simulans
Ênfase
Pesquisa
Data inicial - Data final
13/09/2021 - 30/09/2022
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Biológicas
Resumo
Com raras exceções, os genomas eucariotos são repletos de sequências dispersas de DNA repetitivo, os quais, na maioria, são derivados de Elementos de Transposição (TEs) (Feschotte, 2008). Os TEs são sequências com habilidade de, por diferentes mecanismos, alterarem sua posição no genoma e se replicarem dentro dele. Sua mobilização causam mutações que podem ser deletéria, neutra ou adaptativa. Estudos têm sugerido que os TEs têm papel fundamental na evolução dos genomas. O ciclo de um TE envolve: (1) invasão de um genoma, (2) aumento de cópias e dispersão no genoma hospedeiro, (3) regulação da mobilidade pelo próprio elemento e pelo hospedeiro, (4) acúmulo de mutações nos TEs com perda da identidade ou domesticação de partes da sequência (Schaack et al., 2010). Durante todo este processo, a sequência é transmitida verticalmente de pais para filhos. Porém, antes da perda de sua identidade, o TE passa por (5) transferência horizontal, onde o elemento “salta” para uma outra espécie, sendo este processo crucial para a manutenção da sequência funcional do mesmo. Apesar de haver fortes evidências de transmissão horizontal, o processo ainda é passível de estudos que mostrem como isso ocorre. A transmissão horizontal é sugerida quando a filogenia das espécies envolvidas não é compatível com a filogenia do TE, ou quando há descontinuidade da presença do TE em grupos relacionados filogeneticamente (Daniels et al. 1990, Robertson e Lampe 1995, Arcà e Savakis 2000, Terzian et al. 2000, Almeida e Carareto 2005, Loreto et al. 2001). Uma menor taxa de substituições sinônimas de nucleotídeos da sequência dos TEs comparada com a de genes nucleares, reforça a ideia de transferência horizontal (Ludwig e Loreto 2007). Porém, Capy et al. (1994) e Cummings (1994) chamam a atenção para a possibilidade destas características serem consequência de polimorfismo ancestral do TE, taxas evolutivas diferentes (lembrando que os TEs estão inseridos em locais diferentes dos genomas e possuírem valores adaptativos diferentes) e/ou perdas estocásticas ao longo da evolução das espécies. Recentemente, foi descrita a transferência horizontal do TE P para D. simulans, provavelmente originada de D. melanogaster (Kofler et al., 2015) devido a alta identidade da sequência do TE das duas espécies (diferença de um único nucleotídeo). Estas espécies compartilham recursos tróficos, que possibilitaria a transferência, e há relato de introgressão. A primeira evidência da invasão foi em uma coleta em Portugal em 2006 onde parte dos indivíduos da amostra tinha o elemento (Hill; Schlotterer; Betancourt, 2016). Em 2013, todos os indivíduos tinham o elemento. Sugere-se uma dispersão mais rápida do que a registrada para o mesmo elemento em D. melanogaster (Anxolabehere; Kidwell; Periquet, 1988). Isto pode ter ocorrido devido a taxas menores de disgenesia do híbrido em D. simulans em comparação com D. melanogaster (Hill; Schlotterer; Betancourt, 2016). Porém, a rápida dispersão de D. simulans com o elemento P entre os continentes pode ser o resultado do transporte dessa espécie pelo aumento do comércio de frutas na última década (Yoshitake et al., 2018).

Objetivo Geral

Objetivos:
I. Estimar o período de invasão do elemento P nas linhagens do Brasil;
II. Obter a identidade de parte da sequência do elemento P nas diferentes linhagem e verificar a taxa de mutação;
III. Determinar o local de inserção de algumas sequências de P em uma das linhagens para direcionar os estudos da evolução do P em sítios específicos.

Justificativa

A partir desta invasão recente é possível analisar a história do elemento bem como as consequências para a espécie hospedeira. Para a América do Sul, duas linhagens de D. simulans sem o elemento foram registradas, uma do Peru, em 2000, e outra do Brasil, em 2004 (Hill; Schlotterer; Betancourt, 2016). A partir disso, linhagens coletadas em diferentes anos foram estudadas e a linhagem do Brasil mais antiga com o elemento P é de 2007 (Abelaira, 2019). Ainda, para linhagens do Brasil, Nascimento et al. (2020), sugerem que as linhagens de 2018 e 2019 possuem de 11 a 20 cópias do elemento. O estudo justifica-se pelo fato de D. simulans ser o modelo para o entendimento da regulação do elemento P e registro do processo invasivo. Devido a coletas frequentes do grupo de pesquisa no Brasil, é possível colaborar com o entendimento da invasão e o estudo comparativo de linhagens dispersas auxiliam na compreensão do processo de silenciamento.

Metodologia

Manutenção de linhagens de D. simulans: linhagens de D. simulans serão mantidas em câmera climatizada, em meio de cultura ágar-banana e replicadas semanalmente. As linhagens serão usadas na investigação dos elementos, controle de reação de PCR e relato de disgenesia do híbrido de cruzamentos específicos.

Extração de DNA: será feita de cinco indivíduos de cada coleta, utilizando o kit Dneasy Blood & Tissue Kit, seguindo protocolo do fabricante (Qiagen). Boa parte das amostras já estão disponíveis (Abelaira, 2019) e a extração será feita de amostras de D. simulans de diferentes locais e datas coletadas no Brasil, disponibilizadas pelo LABDROS, da UFSM e Laboratório de Drosophila da UFRGS.

Amplificação por PCR: a PCR será realizada para detectar a presença do elemento na espécie hospedeira e para obtenção de sequências que serão analisadas quanto às mutações. Os primers usados nos estudos são ORF2 forward (5´ACATATTAACAAGCCGTCTCA3´) e ORF3 reverse (5´TGCTTAACATCTCATCGACA3´) (Abelaira, 2019); e o primer ITR (Haring et al., 1995) (5´CATGATGAAATAACATAAGGTGGTCCCGTCG3´).

Sequenciamento: os produtos de PCR serão purificados por PureLink PCR purification kit (Invitrogen) e encaminhados para sequenciamento em ambas orientações na empresa Macrogen. Os eletroferogramas serão analisados e editados utilizando o programa Staden 3.3 (Staden, 1996). A comparação das sequências será feita por alinhamento no programa MEGA 5.0 (Tamura et al., 2011).

PCR invertido: O DNA genômico de D. simulans coletada em 2021 no Campus Capão do Leão da UFPel será clivado por enzima de restrição EcoRI, religado com enzima T4 DNA ligase e será feita PCR usando primers que direcionam para as regiões que flanqueiam o elemento P 5′‐AAATTCGTCCGCACACAACC‐3′ e 5′AATCTTCACGGACACGCAGA‐3′ (Yoshitake et al., 2018). As sequências serão obtidas na PCR invertida serão purificadas e sequenciadas em ambas orientações na empresa Macrogen. Os eletroferogramas serão analisados e editados utilizando o programa Staden 3.3 (Staden, 1996). A identidade das sequências será obtida por Blast no genoma de D. simulans.

Indicadores, Metas e Resultados

Espera-se estimar a linhagem mais antiga que possuía o elemento P no Brasil e verificar o aumento do número das sequências ao longo dos anos. Descrever alguns sítios de inserção destas sequências, para assim realizar abordagem evolutiva.

Metas e indicadores:
- Formação de pessoal qualificado na área de Genética: formação 1 Mestrado em Genética e Biologia Molecular pela UFRGS;
- Fortalecer interação com outras Instituições e grupos de pesquisa, colaborando no desenvolvimento dos estudos, ampliando o uso de técnicas e abordagens: proposição de projetos e publicação em conjunto;
- Estabelecer novas metodologias de estudo: envolvimento de mais colaboradores no projeto (iniciação científica, mestrandos e doutorandos);
- Divulgação dos resultados obtidos: 2 Resumos em Congresso Nacional ou Internacional da área de Genética e/ou Evolução e 1 artigo em revista Qualis A2 na área de Genética e/ou Evolução.

Equipe do Projeto

NomeCH SemanalData inicialData final
MARINDIA DEPRA
MONICA LANER BLAUTH14
VERA LÚCIA DA SILVA VALENTE GAIESKY
YASMIN ABELAIRA SILVEIRA

Página gerada em 10/08/2022 03:06:27 (consulta levou 0.056005s)