Nome do Projeto
Staphylococcus multirresistente: Fontes animal, ambiental e humana para o leite
Ênfase
Pesquisa
Data inicial - Data final
01/11/2020 - 29/02/2024
Unidade de Origem
Coordenador Atual
Área CNPq
Ciências Agrárias
Resumo
Staphylococcus aureus estão entre os agentes mais identificados em surtos de doenças transmitidas por alimentos. Esses micro-organismos geram grande preocupação em saúde pública, não só pela produção de toxinas termorresistentes, causadoras das intoxicações alimentares, mas também por causarem infecções em humanas, apresentarem diferentes fatores de virulência e elevada resistência a antimicrobianos. Assim, este projeto tem por objetivo identificar a ocorrência de Staphylococcus aureus meticilina resistente (MRSA) entre os isolados de Staphylococcus coagulase positiva, formadores de biofilme, oriundos de fontes animal, ambiental e humana durante a ordenha. Para isso, os isolados de Staphylococcus coagulase positiva serão identificados genotipicamente por multiplex reação da polimerase em cadeia - mPCR, e submetidos ao teste de sensibilidade à meticilina. Novas ações buscando avaliar o perfil de resistência dos isolados deverão ser inseridas ao projeto.

Objetivo Geral

Avaliar o perfil de resistência de isolados de Staphylococcus do ambiente de ordenha frente a antimicrobianos e demais substâncias alternativas, como fitoterápicos e óleos essenciais. Especialmente, identificar Staphylococcus meticilina resistente dentre os isolados coagulase positiva, oriundos de fontes animal, ambiental e humana durante a ordenha, demostrando estas fontes como potenciais riscos à saúde pública.

Justificativa

De acordo com dados divulgados pelo Sistema Nacional de Agravos e Notificações, da Secretaria de Vigilância em Saúde (SINAN/SVS) – Ministério da Saúde, entre os anos de 2009 e 2018, foram notificados 6.903 surtos de doenças transmitidas por alimentos (DTA) no Brasil. Destes, apenas 2.403 tiveram a identificação do alimento causador. O leite e seus derivados foram responsáveis por 7,9% dos casos de DTA, ficando atrás dos surtos envolvendo o consumo de alimentos mistos e de água. Entre os agentes etiológicos mais identificados nesses surtos, está o Staphylococcus aureus (BRASIL, 2019). Durante sua multiplicação no leite e derivados, cepas enterotoxigênicas da bactéria produzem toxinas termo-estáveis causadoras de intoxicações alimentares que cursam com náuseas, vômitos e diarréia quando ingeridas em quantidade suficiente.
Outra grande preocupação relacionada à saúde pública é a resistência aos antimicrobianos apresentada por algumas cepas de Staphylococcus spp. Sabe-se que Staphylococcus aureus são importantes causadores de infecções na glândula mamária de bovinos de leite (LEE et al.,2012), onde o tratamento de eleição é a antibioticoterapia. Contudo, o uso indiscriminado dos antimicrobianos gera o risco de resíduos no leite, o que contribui para a contaminação do ambiente, da cadeia alimentar e no surgimento de cepas resistentes às drogas de importância para a saúde humana (SILVA et al., 2018).
Cepas de Staphylococcus aureus resistentes à meticilina (MRSA) são comumente relatadas como causadoras de infecções hospitalares e de unidades de terapia intensiva (UTI). A resistência à meticilina e por consequência, aos antibióticos β-lactâmicos, dificulta o tratamento em casos de infecções humanas (RABELO et al., 2014) e em animais (GUIMARÃES, 2011).
A meticilina não é o antimicrobiano geralmente utilizado no tratamento de mastites, porém, cepas de MRSA já foram identificadas em fazendas leiteiras, evidenciando que o contato entre humanos e animais pode favorecer a transmissão dessas cepas (LIM et al., 2013). Uma vez que os animais são produtores de alimento para consumo humano, ressalta-se o risco de transmissão cruzada entre as espécies de cepas resistentes (GUIMARÃES, 2011).
O ambiente também pode ser uma das fontes de infecção de MRSA para os animais, uma vez que podem sobreviver durante meses no ambiente, desde que existam condições, como umidade e temperatura, favoráveis a sua manutenção (SILVA et al., 2018). Durante um estudo em fazendas leiteiras na Coréia, LIM et al. (2013) isolaram cepas de Staphylococcus spp. resistentes à meticilina de teteiras, pisos, cercas e sistemas de ventilação, destacando a necessidade de medidas preventivas quanto à transmissão dessas cepas entre humanos, animais e ambiente das fazendas.
Segundo LANDERS et al. (2012), é necessário considerar a interação complexa dos elementos do ambiente físico (ar, solo e água) com trocas sociais (por exemplo, entre os animais de um rebanho, entre agricultores e animais, entre aves domésticas e aves migratórias), das etapas de processamento (atividades agrícolas, transporte e armazenamento) e nos padrões de uso humano (preparo e consumo dos alimentos, suscetibilidade à infecção) para compreender como o uso de antibióticos em animais pode impactar no desenvolvimento de resistência a antibióticos. Nesse contexto, micro-organismos resistentes aos antibióticos podem ser encontrados em alimentos de origem animal ou disseminados através do ambiente, como água e solo.
Considerando-se o conceito de Saúde única, onde saúde humana, animal e ambiental estão relacionadas, a resistência aos antibióticos tem grande impacto na saúde pública, dessa forma, faz-se necessário compreender e identificar a ocorrência de micro-organismos resistentes na cadeia produtiva de alimentos de origem animal (BRASIL, 2018a).
Além dos mecanismos tradicionais de resistência, uma característica especial de Staphylococcus aureus é sua capacidade de sobreviver em superfícies bióticas e abióticas no estado de biofilme, que são comunidades bacterianas envoltas de matriz celular polimérica (CHAGAS et al., 2015). Essa habilidade de formar biofilme confere ao S. aureus um importante fator de virulência, pois são mais difíceis de serem eliminados do que as bactérias na forma planctônica e pode aumentar a resistência dos micro-organismos aos antimicrobianos (SIMÕES et al., 2010; KASNWSKI et al., 2010).
A existência de cepas formadoras de biofilme nos equipamentos e utensílios de ordenha acarreta no risco de contaminação do leite cru, pelo eventual desprendimento das porções aderidas, podendo apresentar riscos à saúde do consumidor e de contaminação entre os animais (CHAGAS et al., 2017).

Metodologia

Obtenção dos Isolados
Serão analisadas um total de 40 isolados de Staphylococcus coagulase positiva, oriundos de quatro propriedades leiteiras localizadas no sul do Rio Grande do Sul. Todas participantes do projeto de extensão “Manejo de ordenha e qualidade do leite em propriedades do sul do Rio Grande do Sul”. Foram realizadas quatro coletas em cada propriedade, com intervalos semanais, entre os anos de 2014 e 2016 (SANTOS et al., 2016, ROSA et al., 2018). Após identificação e contagem de Staphylococcus coagulase positiva em cada ponto amostrado, que foram mãos do ordenhador, superfície dos tetos e insufladores de teteiras imediatamente antes de iniciar a ordenha, os isolados foram armazenados em cultivos de estoque.

- Identificação genotípica
Os isolados de Staphylococcus coagulase positiva serão recuperados em Caldo de Infusão Cérebro e Coração (BHI) e mantidos em estufa a 37ºC por 24h.
O DNA dos isolados será extraído conforme Sambrook e Russel (2001). O pellet será obtido por centrifugação de 1 mL de cultura em BHI, ressuspendido em 150 μL de tampão STES [Tris-HCl 0,2 M, NaCl 0,5 M, SDS 0,1% (m/v), EDTA 0,01 M, pH 7,6]. Serão adicionados 50 μL de pérolas de vidro e 150 μL de fenol-clorofórmio. Para completar a lise celular dos isolados de Staphylococcus coagulase positiva, serão adicionados 1,5μL de solução de lisostafina (100 μg/mL de lisostafina em tampão de acetato 20 mM) após obtenção do pellet obtido pela centrifugação de cultura em BHI e incubado a 37°C por 1 h. Após homogeneização em vórtex por 1 min, a mistura será centrifugada a 13.000 g por 5 min. O sobrenadante será coletado e em novo eppendorf serão adicionados 10 μL de acetato de potássio 3M e 200 μL de etanol absoluto. Após homogeneização, será colocado em freezer -20°C por 1h. Uma nova centrifugação será realizada a 13.000 g por 20 min, onde o sobrenadante será descartado e o pellet lavado com 500 μL de etanol 70%, seguido de eluição em 45 μL de tampão (Tris-HCl 10 mM, EDTA 1 mM, pH 7,4). O DNA extraído será mantido em estoque a -20ºC.
A identificação molecular será realizada por meio da técnica de multiplex PCR (multiplex reação da polimerase em cadeia - mPCR), na qual serão utilizados três pares de primers com o objetivo de diferenciar as três principais espécies de Staphylococcus coagulase positiva: S. aureus, S. intermedius e S. hyicus. A identificação das espécies será feita pesquisando-se a presença do gene nuc utilizando os primers identificados na tabela 1.

Tabela 1 - Primers utilizados na identificação das espécies de Staphylococcus coagulase positiva.
Primer Sequência (5’ a 3’) Gene alvo Tamanho esperado da amplificação (pb) Espécie
au-F3 TCGCTTGCTATGATTGTGG nuc 359 S. aureus
au-nucR GCCAATGTTCTACCATAGC
in-F CATGTCATATTATTGCGAATGA nuc 430 S. intermedius
in-R3 AGGACCATCACCATTGACATATTGAAACC
hy-F1 CATTATATGATTTGAACGTG nuc 793 S. hyicus
hy-R1 GAATCAATATCGTAAAGTTGC


-Testes de sensibilidade à meticilina
Para a realização dos testes de sensibilidade à meticilina, será utilizado o método de disco-difusão de Bauer (BRASIL, 2003). Os isolados serão cultivados em caldo Brain Heart Infusion (BHI, MERCK, Alemanha) e incubados a 36°C/24h, padronizados em absorbância de 0,500nn e semeados em placas de ágar Mueller Hinton (KASVI, Itália), onde será adicionado um disco de cefoxitina (CFO 30μg). As placas serão incubadas invertidas em estufa 36°C ± 1°C durante 24 horas, e após esse período será realizada a leitura dos diâmetros dos halos inibitórios com auxílio de régua graduada. A interpretação dos resultados ocorrerá de acordo com recomendado pelo Clinical and Laboratory Standard Institute (CLSI, 2015) – serão considerados resistentes os halos ≤ 21 mm e sensíveis aqueles ≥ 22 mm.

Indicadores, Metas e Resultados

Após a identificação de Staphylococcus aureus meticilina resistente (MRSA) entre os isolados de Staphylococcus coagulase positiva, espera-se, como resultado, comprovar a importância das fontes ambiental, animal e humana de MRSA para o leite, evidenciando o impacto deste isolamento como risco à saúde pública.

Equipe do Projeto

NomeCH SemanalData inicialData final
BRUNA GAROFALI SIMONE DRABER
CAROLINE DA LUZ DE FREITAS
CLAUDIO DIAS TIMM1
DANIELE BONDAN PACHECO
FERNANDA DE REZENDE PINTO1
HELENICE GONZALEZ DE LIMA2
JÉSSICA DAL VESCO
LISIANE CRUZ DA SILVA1
MAYRA ROCHA
NATACHA DEBONI CERESER3
RITA DE CASSIA DOS SANTOS DA CONCEICAO1

Página gerada em 17/09/2021 01:51:34 (atualização a cada 15 minutos)